After learning about the vast open genomic databases online, you now spend your free time browsing the disease databases to identify the molecular basis of cancer. Looking at RNA sequencing data, you find that a particular RNA is upregulated in pancreatic cancer. How would you prove that this RNA is a lncRNA and not a protein coding gene?

A. Sequence the RNA to see if it has a polyA tail

B. Inject the RNA if it causes cancer it is a lncRNA

C. Inject the RNA if it causes cancer, but not if you inhibit Dicer it is a lncRNA

D. Inject the RNA if it causes cancer and continues to causes cancer even if you inhibit the Ribosome it is a lncRNA

E. Inject the RNA and see if causes cancer and if changes result to the chromatin/epigenetic structure occur then it is a lncRNA

D. Inject the RNA if it causes cancer and continues to causes cancer even if you inhibit the Ribosome it is a lncRNA

You spend the summer in a fly research lab where you discover a three winged, red eye fly with a striped pointed abdomen. To determine if the three winged mutation is recessive or dominant you cross it to a normal (two-winged), white eyed, fly with a rounded dark abdomen. In your F1 generation, you find only two groups of phenotypes, three winged, red eye, rounded dark abdomen flies and two winged, red-eye, flies with striped pointed abdomens in equal proportion. The graduate student you are working with notices your results and says “good job mapping the location of the three-winged mutation. Where is the mutation?

A. Chr. 1

B. Chr. 2

C. Chr. 3

D. Chr. X

E. Chr. Y

F. The graduate student was wrong, you can’t map the location of this mutation with this data.

D. Chr. X

Morgan crossed true breeding red eye (G+), Long leg (SL+) females with true breeding green eye (g), short leg (sl) males. F1 animals (red eyes and long legs) from this cross were then backcrossed to true breeding green eye (g), short leg (sl) animals. If the G and SL genes are 22 cM apart on the same chromosome. In what proportion show he expect to find green eye, short leg animals?

0.39

If the following DNA contained a ________; which mutation would be the most deleterious (bad) to that DNA element. (Choose the mutation that would be worse if it occurred in that element.) Answers may be used more than once.

Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

1 GGAACAGAAAGAAATGGATTAATCTGCTCTTCGCGTTGAAGCC…

2 GGAACAGAAAGAAATGGATTTACTTCGCGTTGAAGCCTTTAAA…

3 GGAACAGAAAGAAATGGATTTATTTAAATCTGCTCTTCGCGTT…

4 GGAACAGAAAGAAATGGATTTATCAGCTCTTCGCGTTGAAGCC…

5 GGAACAGAAAGAAATGGATTTATCTGCTTTTCGCGTTGAAGCC…

6 GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCCTTGAAGCC…

A. Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

2 GGAACAGAAAGAAATGGATTTACTTCGCGTTGAAGCCTTTAAA…

B. Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

1 GGAACAGAAAGAAATGGATTAATCTGCTCTTCGCGTTGAAGCC…

C. Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

3 GGAACAGAAAGAAATGGATTTATTTAAATCTGCTCTTCGCGTT…

D. Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

4 GGAACAGAAAGAAATGGATTTATCAGCTCTTCGCGTTGAAGCC…

E. Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

5 GGAACAGAAAGAAATGGATTTATCTGCTTTTCGCGTTGAAGCC…

F. Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

6 GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCCTTGAAGCC…

MicroRNA

A.

Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

2 GGAACAGAAAGAAATGGATTTACTTCGCGTTGAAGCCTTTAAA…

Protein coding gene

B.

Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

1 GGAACAGAAAGAAATGGATTAATCTGCTCTTCGCGTTGAAGCC…

LncRNA

A.

Wt GGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGCC…

2 GGAACAGAAAGAAATGGATTTACTTCGCGTTGAAGCCTTTAAA…

A population of rhinos consists of either long tusked (the dominant phenotype) or tuskless (the recessive phenotype) animals. Long tusk animals have the genotype T/T or T/t, while tuskless animals have the genotype t/t. Asuming a HWE, if the frequency of long tusk animals is 0.64, what is the expected frequency of the t allele in the population? HWE = Hardy-Weinberg equilibrium. Write your answer as decimal/frequency (not percent), format as a decimal to 3 decimal places X.XXX

0.600

Some viruses like HERV integrate into human genomes and continually create havoc for the cells and the tissue. How could the cell heritably silence the region of genome in which the virus integrated, so that the cell could continue to live and do well?

A. Use CRISPR/Cas9 to make a mutation in the viral DNA

B. Inhibit RNA polymerase II, so that the viral DNA could use that enzyme to make viral RNA and proteins.

C. Use a microRNA to make a mutation in the enhancer, so that it could evolve a away from that virus.

D. Methylate the DNA around the viral insertion site

E. De-methylate the DNA around the viral insertion site.

D. Methylate the DNA around the viral insertion site

How would glucose affect the Lac Operon if there was an amorphic mutation in the CAP, particularly as it relates to LacZ expression?

a. Glucose addition in the mutants would cause a reduction in LacZ expression

b. Glucose addition in the mutants would cause an increase in LacZ expression

c. Glucose addition in the mutants would not change LacZ expression

d. Glucose addition in the mutants would cause LacZ expression to fluctuate

e. None of the above

c. Glucose addition in the mutants would not change LacZ expression

You find two separate mutations that affect the number of heart cells, tin-man (tm) and vampire (va). In order to determine the relationship between tin-man and vampire you examine the number cells in the hearts of tm/tm single mutants, va/va single mutants and tm/tm; va/va double mutant embryos (see below). What is the relationship between these two mutations.

a. tm complements va

b. va complements tm

c. tm is epistatic to va

d. va is epistatic to tm

e. These genes belong to quantitative trait loci (QTLs) involved in cardiac cell number

d. va is epistatic to tm

What type of mutation is most likely found in oncogenes?

a. Homozygous hypomorph

b. Heterozygous hypomorph

c. Homozygous hypermorph

d. Heterozygous hypermorph

e. Homozygous antimorph

d. Heterozygous hypermorph

As a hallmark of the maternal effect, what is responsible for offspring phenotypes?

1. Mitochondrial DNA
2. Mother genotype
3. Father genotype
4. Offspring genotype

2. Mother genotype

Consider a diploid organism that is 2n=56. After meiosis II and including cytokinesis, how many cells are produced and how many chromosomes are present in each cell?

1. Two cells; 28 chromosomes each
2. Four cells; 56 chromosomes each
3. Two cells; 56 chromosomes each
4. Four cells; 28 chromosomes each

d. Four cells; 28 chromosomes each

If you had an organism that expressed a dominant phenotype, but wanted to know if it was a carrier of the recessive allele, what would be the best way to determine its genotype?

1. Cross your organism with an organism that you know is heterozygous
2. Look at the parents of your organism to infer from their phenotypes
3. Perform a reciprocal cross
4. Perform a test cross
5. Map their genome

d. perform a test cross

What is the physical basis for the independent assortment observation that Mendel made?

1. Male and female gametes are produced in separate organs in separate individuals
2. There are two chromosome divisions in meiosis
3. Recombination (crossing over) occurs in meiosis
4. Homologous chromosomes are randomly separated during meiosis I
5. Sister chromatids do not separate until meiosis II

d. Homologous chromosomes are randomly separated during meiosis I

An evolutionarily significant benefits of meiosis that is not present in mitosis is the rearrangement of alleles. During which processes does this occur?

1. Reduction in the number of chromosomes
2. Independent assortment
3. Duplication in the number of chromosomes
4. Equal segregation of chromosomes into individual gametes
5. None of these

b. independent assortment

Peas heterozygous for three independently assorting genes were intercrossed. What proportion of the offspring will be homozygous for the recessive allele of at least one gene? (Answer as a decimal to 3 places)

0.578

As a researcher interested in cancer you discover a mutation (d/d) in mice that causes cancer in 20% of individuals homozygous for the mutation. Describe this phenomena.

Incomplete penetrance (only 20% penetrant)

You find that one of your patients has hypercholesterolemia even though they are very young. Neither of the child’s parents had high cholesterol as a child nor do they have a family history of high pediatric cholesterol. However, as their genetic counselor you suspect a genetic cause. In order to identify the source of high cholesterol in your patient, what experiment would you perform?a. A pedigree analysis of members of the patient’s family including siblings, parents and grandparents

b.A GWAS study including the patient and other kids with high cholesterol and kids without high cholesterol

c.Whole genome sequencing of the patient and her parents

d.A genetic screen in zebrafish for mutations that cause high cholesterol levels

e.Prescribing cholesterol lower drugs, with known targets, one at a time to see which one works.

c. Whole genome sequencing of the patient and her parents

Specific pediatric cancers are caused by mutations changing a proto-oncogene into an oncogene. What type of genetic mutation most likely underlie this change?

A.Cigarette/Vape smoke

B.Amorph

C.Hypermorph

D.Nonsense

E.Synonymous missense

c. hypermorph

What type of cell biological pathways are often defective in cancer?

A.Replication*

B.Transcription

C.Translation

D.DNA surveillance*

E. Two of these are correct

e. two of these are correct

What is similar between RISC and Cas9?

A.They both create double strand breaks

B.They both ligate DNA

C.They both are “biological scissors”

D.They both work with RNAs that guide them to their target

E.None of the above

d. They both work with RNAs that guide them to their target

Classify the following as either cis- or trans-acting.

1. Promoter
2. Transcription factors that bind to cis-elements and repress/activate them
3. Enhancer
4. Insulator

a. Promoter cis

b. Transcription factors that bind to cis-elements and repress/activate them trans

c. Enhancer cis

d. Insulator cis

How will glucose presence affect the expression of cAMP? (increase or decrease)

cAMP levels will decrease

Predict the level of gene expression of the lac operon as well as the status of the lac repressor and the CAP protein, when bacterial growth media contain the following sugars:

1. No lactose or glucose
2. Lactose only
3. Glucose only
4. Lactose and glucose

1. No lactose or glucose -- lac operon not expressed, lac I repressor gene is bound to operator
2. Lactose only-- lac operon is expressed; lactose binds to the lac I repressor gene, causing allosteric change so that it cannot bind to the operator
3. Glucose only-- lac operon not expressed; decrease cAMP levels, decreases the probability of pol2 binding
4. Lactose and glucose -- lac operon not expressed; glucose decreases cAMP levels, decreasing probability that pol2 binds

Which would not be a way in which cells could stop a native proteins function?

1. Sequester the mRNA for that gene from the ribosomes
2. Express an inhibitor of the protein
3. Degrade the protein using microRNAs or siRNAs
4. inducing mutations to the enhancer
5. Make changes to the transcription factors

d. inducing mutations to the enhancer

Where, on the gene, is methylation most likely to take place?

1. 1
2. 2
3. 3
4. 4
5. None of the above

b. 2

How could you prove that Junk DNA is Junk?

A. Conduct a screen

B. Remove the Junk DNA and see what happens

C. Compare complex organisms with non-complex organisms to see who has more 'Junk' DNA

D. See if the Junk DNA is transcribed

E. See if that DNA is replicated

B. Remove the Junk DNA and see what happens

Andrew Fire and Craig Mello won the Noble prize for their work on microRNA, in class we went over one of the papers Titled “Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans” What genetic methodology that we’ve discussed in class is used in this paper?

A. Requirement

B. Reciporical Cross

C. Crispr/Cas9

D. Forward Genetics

E. Sufficiency

e. Sufficiency

How would glucose affect the Lac Operon if there was an amorphic mutation in the CAP, particularly as it relates to LacZ expression?

a. Glucose addition in the mutants would cause a reduction in LacZ expression

b. Glucose addition in the mutants would cause an increase in LacZ expression

c. Glucose addition in the mutants would not change LacZ expression

d. Glucose addition in the mutants would cause LacZ expression to fluctuate

e. None of the above

c. Glucose addition in the mutants would not change LacZ expression

How does acetylation to a histone tail affect transcription?

A. It decreases transcription by opening up the chomatin

B. It increases transcription by opening up the chomatin

C. It decreases transcription by closing the chromatin

D. It decreases transcription by opening the chromatin

E. It doesn't affect transcription

B. It increases transcription by opening up the chomatin

What is similar between RISC and Cas9

A. They both create double strand breaks

B. The both DNA

C. The both cut RNA

D. They both work with RNAs that guide them to their target

E. None of the above

D. They both work with RNAs that guide them to their target

Match the elements with whether they regulate transcription in Cis or Trans.

Enhancer

Dicer

Promotor

3'UTR

microRNA

Transcription factor

Histone Modifications

DNA Methylation

CAP protein

Enhancer= cis

Dicer= trans

Promotor= cis

3'UTR= cis

microRNA= trans

Transcription factor= trans

Histone Modifications= cis

DNA Methylation= cis

CAP protein= trans

What type of cell biological pathways are often defective in cancer? (There is more than one correct answer)

A. Replication

B. Transcription

C. Translation

D. DNA surveillance

E. Cell migration

F. Mitochondrial function

a. replication

d. DNA surveillance

T/F: Specific pediatric cancers are caused by mutations changing a proto-oncogene into an oncogene are usually amenable to transgenic gene therapy techniques.

FALSE

Specific pediatric cancers are caused by mutations changing a proto-oncogene into an oncogene. What type of genetic mutation most likely underlie this change?

a. Cigarette/vape smoke

b. amorph

c. hypermorph

d. nonsense

e. synonymous missense

c. hypermorph

How does CAP (catabolite activation protein levels change in response to glucose?

a. increases

b. decreases

c. stays the same

d. depends whether there is lactose present.

c. stays the same

In e-coli, which of the following elements act in Cis?

a. LacI

b. Lac operator

c. Lac promotor

d. LacZ

e. LacA

f. LacY

g. LacQ

b. Lac operator

c. Lac promotor

In e-coli, which of the following elements are expressed in the presence of glucose and lactose?

a. LacI

b. Lac operator

c. Lac promotor

d. LacZ

e. LacA

f. LacY

g. LacQ

a. LacI

In e-coli, which of the following elements are expressed in the presence of lactose?

a. LacI

b. Lac operator

c. Lac promotor

d. LacZ

e. LacA

f. LacY

g. LacQ

a. LacI

d. LacZ

E. LacA

f. LacY

Which of the following is a way a cell uses to stop the function of one of its own proteins? (Choose all that apply)

A. Close the chromatin around a gene, so that transcription factors can’t bind

B. Make a mutation in the first exon

C. Make a nonsense mutation in the first exon after the start site

D. Degrade RNA polymerase so it can't transcribe the gene

E. Degrade a mRNA transcript once it has been made, via microRNAs

F. Inhibit transcription of that gene– via changes in transcription factors (trans-acting molecules) that function at the enhancer

G. Inhibit transcription of that gene– via mutations at the enhancer

H. Degrade a mRNA transcript once it has been made, via microRNAs

I. Sequester the mRNA for that gene from ribosomes

J. Stop the protein's function, by expressing another protein that is an antagonist

A. Close the chromatin around a gene, so that transcription factors can’t bind

E. Degrade a mRNA transcript once it has been made, via microRNAs

F. Inhibit transcription of that gene– via changes in transcription factors (trans-acting molecules) that function at the enhancer

H. Degrade a mRNA transcript once it has been made, via microRNAs

I. Sequester the mRNA for that gene from ribosomes

J. Stop the protein's function, by expressing another protein that is an antagonist

What previous concept that we learned does the Cre/LoxP system employ?

a. Linkage disequilibrium

B. Independent assortment

C. Wobble position

D. Reductionism

E. Recombination

e. Recombination

What components are part of the CRISPR/Cas9 system that are injected in exogenous cells?(Check all that apply?)

A. mRNA

B. TracrRNA

C. crRNA

D. Cas9

E. PAM site

F. rRNA

G. Fok1

B. TracrRNA

C. crRNA

D. Cas9

Look up the cause of huntington's disease, which gene therapy technique - transgenics or CRISPR/Cas9 do you think would be appropriate and why?

A. Transgenics because it would allow you to remove the mutated HTT gene.

B. Transgenics because it would allow you to add an additional normal copy of the HTT gene

C. CRISPR/Cas9 because it would allow you to remove the mutated HTT gene

D. CRISPR/Cas9 because it would allow you to add a normal copy of the HTT gene

C. CRISPR/Cas9 because it would allow you to remove the mutated HTT gene

Are there any requirements regarding the sequence that can be targeted by CRISPR/Cas9? If so what are they?

A. No, there are no requirements any sequence can be targeted thats why it is so awesome

B. Yes, NGG must be immediately downstream of the target sequence

C. Yes, NGG must be immediately Yesupstream of the target sequence

D. Yes, the target sequence must be a viral sequence

E. Yes, the sequence must contain the crRNA sequence

B. Yes, NGG must be immediately downstream of the target sequence

Jeremy notices that his friend Dan (the son of Robyn, a single parent) has the same laugh and dimples as the longtime mailman. Ignoring ethical and privacy concerns, Jeremy decides that since he has just learned about PCR in class, he will perform a paternity test on the side during his BISC 336 lab to determine whether Mike is related to the mailman. He obtains hair samples from all three.

>10 million DNA molecules/genomes are needed to analyze or sequence a polymorphism. Jeremy was only able collect 5 cells from each individual. What is the minimal number of PCR cycles Jeremy will need to perform

21

What are essential components of a plasmid for cloning? Choose all that apply.

A. crRNA

B. Gene encoding for a restriction enzyme

C. Gene encoding for Cas9

D. Origin of replication

E. TracerRNA

F. Antibiotic resistance gene

G. restriction enzyme target sites

D. origin of replication

f. antibiotic resistance gene

g. restriction enzyme target sites

Sticky ends created by restriction enzymes allow for complementary sequence ends from different pieces of DNA to base-pair together. Is this all you need to clone a gene into bacteria for gene cloning?

A. Yes, thats why its so easy to make a GMO

B. No you also need to seal a nick in the phosphate backbone with a polymerase

C. No you also need to seal a nick in the phosphate backbone with a ligase

D. No you also need to seal a nick in the phosphate backbone with a nickase

E. Yes, this is all you need, to create complementary sticky ends from different pieces of DNA in order to put them together. Although it is not that easy.

C. No you also need to seal a nick in the phosphate backbone with a ligase

You cut the following sequence with the restriction enzyme EcoRI. What will be the size of the smallest when you run this digested DNA on a gel?

5'-CCACATGGAGACGAATTCCGATCAAGTTATGCCCAGCGCCTACGACAGCAAGAGAGGATTCATCGGGC-3'

12

How would you remove the gene NP1 only in neurons cells to see if its involved in pain sensation?

A. CRISPR/Cas9

B. Transgenics

C. Gene therapy

D. TALENs

E. Cre/LoxP

E. Cre/LoxP

What sequence would bind to a sticky end created by BamHI? You will have to do some research for this question. Your answer should be 4 base pairs long written in 5'-3' direction (left to right), no spaces between nucleotides.

GATC

In which methodology is the concept of linkage disequilibrium NOT employed?

a. GWAS

B. Pedigree

C. Recessive Screen with X-rays

D. Determination of Genetic ancestry

E. CRISPR/Cas9

THESE ARE NOT RIGHT:

C. Recessive Screen with X-rays

Which of the following are unbiased techniques to identify genes involved in bone growth? (Choose all that apply)

A. GWAS

B. CRISPR/Cas9

C. Transgenics

D. Cre/LoxP

E. Screen

F. Gene Cloning

THESE ARE NOT RIGHT:

a. GWAS

B. CRISPR/Cas9

C. Transgenics

D. Cre/LoxP

How would you test whether Np1 is sufficient for pain sensation?

A. Use CRISPR/Cas9 to mutate Np1

B. Create a transgene to express Np1 in non-neuronal cells

C. Follow polymorphisms in a pedigree of families with decreased pain sensation

D. Determine if Np1 expression changes during pain sensation

E. Create Np1 protein in bacteria cells to analyze its structure

THESE ARE NOT RIGHT:

A. Use CRISPR/Cas9 to mutate Np1

If you wanted to execute a forward genetic screen for hypomorphic recessive mutations, which type of mutagens would you use? (Choose all the correct answers)

A. X-rays

B. Nuclease which randomly cut DNA

C. ENU or EMS - N-ethyl-N-nitrosourea or Ethyl methanesulfonate

D. UV light

E. Transgenic insertion

THESE ARE NOT RIGHT:

C. ENU or EMS - N-ethyl-N-nitrosourea or Ethyl methanesulfonate

Which of the following is NOT a similarity between CRISPR/Cas9 and restriction enzymes?

A. The both target a specific DNA sequence

B. The both involve enzymes

C. They are both utlized in Genome engineering/Gene cloning

D. They are both part of the bacteria defense against viruses

E. They both create double strand breaks in DNA

THESE ARE NOT RIGHT:

C. They are both utlized in Genome engineering/Gene cloning

Name a technique you would use to assess whether the gene Np1 is required for pain sensation?(Check all that apply)

A. CRISPR/Cas9

B. Transgenic

C. TALENs

D. Conditional KO

E. GWAS

THESE ARE NOT RIGHT:

A. CRISPR/Cas9

B. Transgenic

E. GWAS

Which of the following disease are not suitable for ex vivo gene therapy approaches?

A. Leukemia

B. Brain cancer

C. Myeloma

D. Lymphoma

THESE ARE NOT RIGHT:

D. Lymphoma