Genetics Flashcards

What differentiates a eukaryotic mRNA strand from its precursor RNA?
A. Introns are spliced out
B. Exons are spliced out
C. Methylation and other epigenetic factors are manipulated
D. There is no difference

T/F: 5’ to 3’ of mRNA corresponds to N-to-C terminus in polypeptides
A. True
B. False

List other names for the non-template strand of DNA.

Which two are the correct pairings of promotes sequences and their locations?
A. TATAAT (Pribnow box), -35 bp
B. TATAAT (Pribnow box), -10 bp
C. TTGACA, -35 bp
D. TTGACA, -10 bp

If the template strand of DNA is 5’ATTGGTAGCT3’, what is the sense strand? What is the resulting mRNA strand?

Which of the following is NOT true about sigma factors?
A. Eukaryotic RNA Polymerase recognizes it
B. It recognizes certain specific sequences on the promoter
C. It signals the start of transcription
D. It is required by RNA polymerase to bind to the DNA sequence

T/F: Promotors can vary in strength
A. True
B. False

Which of the following is NOT true regarding initiation of prokaryotic transcription?
A. Sigma factor identifies the promotor region, allowing RNA polymerase
holoenzyme to bind to promoter
B. RNA polymerase holoenzyme unwinds the DNA to make a transcription
bubble
C. Sigma factor remains bound to the RNA polymerase complex throughout the transcription process
D. All of the above are true

T/F: Only one RNA polymerase can bind to a particular DNA strand at a time.
A. True
B. False

Describe Rho-dependent termination of prokaryotic transcription.

T/F: Both Rho independent and dependent termination involve reaching a
transcription sequence roughly 40 nucleotides long.
A. True
B. False

Which of the following is true regarding Rho-independent termination of prokaryotic
transcription
A. The DNA sequence being transcribed contains inverted repeats
B. The RNA molecule forms a hairpin structure
C. There is usually a polyA sequence following the inverted repeats on teh DNA
strand
D. All of the above are true

T/F: Eukaryotic mRNA is usually polycistronic in nature
A. True
B. False

Which of the following is FALSE regarding eukaryotic transcription?
A. In addition to core promoter sequences, eukaryotic DNA also contains
regulatory promoter sequences and enhancers and silencers which regulate
transcription rate.
B. The core promoter is located at the -10 region
C. There are 5 types of RNA polymerases in eukaryotes
D. RNA Polymerase II is mainly responsible for mRNA synthesis in eukaryotes

Which of the following is true regarding eukaryotic transcription?
A. Multiple transcription factors bind to RNA Polymerase II
B. TATA box binding protein (TBP), which is contained within TFIID is crucial for
the identification and binding of RNA Polymerase to the core promoter.
C. After 30 bp, RNA polymerase continues transcription without the rest of its
machinery
D. All of the above are true

Describe how RNA Polymerases I-III terminate transcription in Eukaryotes:

Which FOUR statements below are correct?
A. Both prokaryotic and eukaryotic mRNAs have a 5’ cap
B. Only prokaryotic mRNAs are polyadenylated at the 3’ end
C. In prokaryotes, transcription is coupled to translation
D. Editing of the nucleotides in the pre-mRNA strand is possible and would
change resulting amino acid sequence

E. In Eukaryotes, RNA splicing occurs after the mRNA is transported into the
cytoplasm
F. RNA splicing requires the formation of a spliceosome
G. Both prokaryotic and eukaryotic mRNAs are synthesized by RNA
polymerase

T/F: In eukaryotes, one pre-mRNA strand can only result in one protein.
A. True
B. False

T/F: The promotor region is located downstream of the transcription start site?
A. True
B. False

T/F: mRNA is transcribed from the sense strand of DNA, making the two
complementary.
A. True
B. False

Carefully read the following double stranded DNA. Locate the consensus sequence in
these strands and then answer the following questions.
5’ GCATTATAGCCAAATCTTCAGA 3'
3’ CGTAATATCGGTTTAGAAGTCT 5’

21. What is this consensus sequence called?

Carefully read the following double stranded DNA. Locate the consensus sequence in
these strands and then answer the following questions.
5’ GCATTATAGCCAAATCTTCAGA 3'
3’ CGTAATATCGGTTTAGAAGTCT 5’

22. Is this DNA prokaryotic or eukaryotic?

Carefully read the following double stranded DNA. Locate the consensus sequence in
these strands and then answer the following questions.
5’ GCATTATAGCCAAATCTTCAGA 3'
3’ CGTAATATCGGTTTAGAAGTCT 5’

23. Where is it located relative to the start of transcription?

24. What is this sequence’s equivalent in either prokaryotes or eukaryotes?

25. Which of the following causes DNA and RNA to separate during Rho dependent
termination?
A. Rho’s exonuclease activity
B. Rho’s helicase activity
C. The A-U bond breaks
D. RNA Polymerase cleaves the mRNA off